Archives of Physical Medicine and Rehabilitation
Volume 88, Issue 5 , Pages 617-625, May 2007

Recovery of Function in Skeletal Muscle Following 2 Different Contraction-Induced Injuries

  • Richard M. Lovering, PT, PhD

      Affiliations

    • Department of Physiology, University of Maryland, School of Medicine, Baltimore, MD
    • Corresponding Author InformationReprint requests to Richard M. Lovering, PT, PhD, Dept of Physiology, University of Maryland, School of Medicine, 685 W Baltimore St, Baltimore, MD 21201
  • ,
  • Joseph A. Roche, PT

      Affiliations

    • Department of Physical Therapy & Rehabilitation Science, University of Maryland, School of Medicine, Baltimore, MD
  • ,
  • Robert J. Bloch, PhD

      Affiliations

    • Department of Physiology, University of Maryland, School of Medicine, Baltimore, MD
  • ,
  • Patrick G. De Deyne, MPT, PhD

      Affiliations

    • DePuy Biologics/Cell Biology and Preclinical Evaluation, Raynham, MA.

Article Outline

Abstract 

Lovering RM, Roche JA, Bloch RJ, De Deyne PG. Recovery of function in skeletal muscle following 2 different contraction-induced injuries.

Objective

To determine if the proliferation of myogenic cells is equally important to recovery of contractile function after 2 different types of contraction-induced muscle injuries.

Design

Randomized trial.

Setting

Muscle biology laboratory.

Animals

Adult male Sprague-Dawley rats.

Interventions

Tibialis anterior muscles were injured by a single lengthening contraction with large strain (1R) or multiple lengthening contractions with small strain (MR). The hindlimbs of some animals in each group were irradiated before injury to prevent proliferation of myogenic cells during recovery.

Main Outcome Measures

Contractile tension was measured immediately after injury and 3, 7, 14, and 21 days after injury. Permeation to Evans blue dye was used to assay membrane damage. Centrally nucleated fibers and reverse transcriptase-polymerase chain reaction of myoD and myogenin were used as measures of myogenesis.

Results

Inhibiting myogenesis prevented the recovery of contractile function after MR, but not after 1R. Both protocols caused Evans blue dye uptake immediately after injury, but Evans blue dye was only retained in fibers for several days after 1R. This suggests that membranes reseal after 1R, but not after MR.

Conclusions

The mechanisms that underlie recovery after injuries caused by repeated lengthening contractions and injuries caused by a single lengthening contraction are different. The differences may be important when planning targeted rehabilitation strategies for each type of injury.

Key Words: Muscles, Regeneration, Rehabilitation, Satellite cells, skeletal muscle

 

STUDIES OF SKELETAL MUSCLE injury indicate that recovery of function is associated with activation and proliferation of myogenic cells and that the myogenic response has a critical role in recovery of contractile function. For example, a decrease in myogenic proliferation results in the failure of muscles to recover after repetitive lengthening (“eccentric”) contractions.1 Although there is substantial evidence that proliferation of myogenic cells is required for the return of contractile function after injury, the extent of myogenic response to injury may depend on the degree of damage and the type of stimulus.2, 3 The precise stimulus that initiates the proliferation of myogenic cells is not clear. One plausible theory is that repeated lengthening contractions, as well as other models of injury, induce a robust paracrine response, thereby activating the proliferation of satellite cells that, given the nature and extent of the injury, are required for the recovery of contractile function.4, 5, 6, 7

Proliferation of myogenic cells has a significant role in recovery from many injury protocols that involve the exposure of muscles to repeated contractions,1 usually at relatively low levels of strain. These protocols often involve a large number of repetitions, ranging anywhere from 150 to several hundred maximal lengthening contractions,1, 8, 9, 10 and may provide a model for overuse injuries. Muscle can also be injured by a single lengthening contraction, however,11, 12, 13 and this may provide a better model for an acute muscle strain. The recovery of muscles injured by a single lengthening contraction with a large strain (1 repetition [1R]), like those injured by multiple lengthening contractions with a small strain (multiple repetitions [MR]), is complete and occurs over a period of several weeks.11, 12 Unlike recovery after the MR protocol,10, 14, 15, 16 however, recovery after the 1R protocol is accompanied by only modest levels of inflammation.13 We therefore hypothesized that the nature of the damage to muscles injured by the 1R and MR protocols differed significantly.

We tested this hypothesis in the hindlimb of rats by matching the extent of injury in tibialis anterior muscles resulting from the 2 different protocols. Injury was operationally defined as loss of maximal isometric tension, which is a reliable indicator of injury.17, 18 Using injury protocols that result in an equivalent loss of force allowed us to rule out the possibility that differences in the extent of injury would affect the factors involved in recovery. Our goal was not to describe the biomechanic differences underlying MR or 1R, but to examine 2 different putative recovery mechanisms that were associated with injuries with similar functional loss. We inhibited the proliferation of myogenic cells before both protocols by irradiation and assayed the extent of the myogenic response in recovering muscles by assessing gene expression of myogenic markers and quantifying centrally nucleated fibers. We also assessed damage to the sarcolemma during the injury by measuring the number of myofibers that took up the extracellular dye, Evans blue dye, which we introduced before the lengthening contractions,11 and by immunolabeling for dystrophin, a sarcolemmal protein that is lost from fibers damaged by the 1R protocol.11

Back to Article Outline

Methods 

Injury Induced by a Single, Maximal Lengthening Contraction or Multiple Lengthening Contractions 

Injury induced by a single lengthening contraction was performed as previously described.11, 12 Briefly, male age-matched Sprague-Dawley rats,a weighing 383±12g, were anesthetized with intraperitoneal ketamine and xylazine (at 40 and 10mg/kg of body mass, respectively). With the animal supine, the hindlimb was stabilized and the foot was secured onto a plate, the axis of which was attached to a stepper motor,b a potentiometer to measure range of motion of the ankle, and a torque sensor to ensure that equivalent dorsiflexion forces were exerted. A custom programc was used to synchronize contractile activation and the onset of ankle rotation. For convenience, the left hindlimb was designated as the experimental side and the right hindlimb was designated as the control side.

For the single repetition (1R), the foot was placed orthogonal to the tibia and moved into plantarflexion through a 90° arc of motion at an angular velocity of 900°, beginning 200ms after tetanic stimulation of the tibialis anterior, in a procedure that produced a large and reproducible injury.11

For the multiple repetitions (MR), we reproduced an established injury protocol that uses 150 lengthening contractions, equally spaced apart over 30 minutes, through a smaller arc of motion, and with the muscle in a shorter start position.1 The ankle was dorsiflexed 20° from the perpendicular position and moved into plantarflexion through a 40° arc at 1700°/s. Ankle movement was superimposed onto a tetanic contraction of the dorsiflexors, which was initiated 100ms before movement.

For both injury protocols, the peroneal nerve was dissected free through a small incision at the lateral aspect of the knee and clamped with a subminiature electrode.d Monophasic square pulses, 1ms in duration, were delivered with an S48 Stimulator.e Pulse amplitude was adjusted to optimize twitch tension, and the frequency of pulses was increased until a maximal fused tetany was obtained (usually 75Hz). A stimulation isolation unit (model PSIU6)e was used between the stimulator and electrode to minimize artifact and to ensure that the peak current delivered was no greater than 15mA.

Rats were used according to the guidelines set by the National Institutes of Health Guide for the Care and Use of Laboratory Animals. The University of Maryland Institutional Animal Care and Use Committee approved our procedures.

Gamma Irradiation 

Hindlimbs were subjected to a single, localized dose of ionizing radiation (25Gy at 2.5Gy/min) 30 minutes before the injury. We used an irradiation dose and dose rate identical to that used in previous studies to eliminate proliferation of satellite cells.1, 19, 20 The irradiation was delivered with a Pantak-Seifert 250KpV X-Irradiator.f The radiation beam was focused onto the lower hindlimb, while shielding protected the rest of the body composed of thick lead (fig 1). Ion chamber dosimetryg was performed outside the collimater to ensure that the exact dose was delivered to the hindlimb, as well as inside the collimater (lead shielding), to monitor backscatter of radiation. In addition to animals subjected to injury after irradiation, we irradiated another group of animals (n=15) as controls to determine the effects of gamma irradiation alone.

  • View full-size image.
  • Fig 1. 

    Gamma irradiation before injury. Animals were anesthetized before an injury was induced and 1 of the hindlimbs in the experimental group was subjected to a single localized dose of ionizing radiation (25Gy) to prevent myogenic proliferation during the recovery process. Care was taken to irradiate only the hindlimb by using a collimator and performing ion chamber dosimetry. The collimator has an adjustable opening for the hindlimb and was machined from lead with a base 2cm thick, length of 25cm, width of 8cm, and height of 10cm.

Cardiotoxin and Bromodeoxyuriodine Injections 

We used 6 rats to test the effectiveness of our irradiation protocol in inhibiting proliferation of myogenic cells after injection of cardiotoxin (0.1mL 10μmol in phosphate-buffered saline [PBS]) into the tibialis anterior muscle, which induces a massive myogenic response.21 Three animals received an intraperitoneal injection of bromodeoxyuridine (BrdU) (500mg/kg) 6 hours before muscles were harvested,3, 21 and the number of nuclei with BrdU uptake and centrally nucleated fibers were counted in injured muscles and compared to muscles that were irradiated before injury.

Functional Data 

Contractile force was measured from tibialis anterior muscles of each group on the day of injury (day 0) and at 3, 7, 14, and 21 days after the injury (n=5 animals tested at each time point), as described.11, 12 Briefly, the distal tendon of the tibialis anterior was cut and the muscle was dissected entirely free except for its origin on the tibia. The proximal portion of the distal tendon was secured in a custom-made metal clamp and attached to a load cell (FT03)e with a suture tie (4.0-coated Vicryl). The load cell was mounted onto a micromanipulatorh so that the tibialis anterior could be aligned and adjusted to resting length (L0). The parameters for electric stimulation were the same as those used in the injury protocol. The hardware was calibrated after a 30-minute stabilization period to minimize thermal drift. To assess functional recovery, the injured tibialis anterior was compared with the noninjured tibialis anterior of the same animal.

Hematoxylin and Eosin Staining 

After functional data were collected at the selected time points, tibialis anterior muscles were harvested from the anesthetized rat, snap frozen in liquid nitrogen, and stored at –80°C. The animal was then euthanized with pentobarbital sodium (200mg/kg) administered intraperitoneally. For standard histopathologic evaluation and for counting centrally nucleated fibers, 7μm-thick frozen sections of snap frozen muscle were stained with hematoxylin and eosin. Sections were randomized and viewed at 100× magnification in a light microscope (Axioskop),i and pictures were taken with a digital camera (AxioCam HR using AxioVision 3.0).i Each optical field contained an average of 84±7 fibers and more than 15 fields were counted per muscle.

Ribonucleic Acid Isolation and Reverse Transcriptase Polymerase Chain Reaction 

For reverse transcriptase polymerase chain reaction (RT-PCR), tissue samples were first snap frozen, pulverized, and homogenized in Trizol.j Ribonucleic acid (RNA) was extracted and isolated according to the manufacturer’s protocol, based on published methods.22

Aliquots containing 2μg of total RNA from each sample were reverse transcribed using Thermoscript RTj mixed with oligo-dT in a total volume of 20μL, according to the manufacturer’s protocol. The complementary deoxyribonucleic acid (cDNA) was then mixed with Platinum PCR Supermixj plus 20pmol of the specific primers and amplified for 30 cycles in a GeneAmp PCR System 9700.k Glyceraldehyde 3-phosphate dehydrogenase (GAPDH) was used as an internal control. PCR products were separated on a 1.5% agarose gel by electrophoresis, stained with ethidium bromide, and photographed.l Forward and reverse primers were designed using the National Center for Biotechnology database with Omiga 2.0 software.m The primers used to amplify the reverse-transcribed cDNAs are outlined in table 1.

Table 1. Primers Used for RT-PCR
PrimerNCBI Reference NumberMolecular WeightForward PrimerReverse PrimerTA
MyogeninM017008666 BPCACCTTCCCAGATGAAACCAAGAAGTCACCCCAAGAGC59.4
MyoDM24393654 BPCACTCCTCCAATTGTCCCTTATTTCCAACACCTGAGC58.8
GAPDHM84176495 BPACGACCCCTTCATTGACCATCACGCCACAGCTTTCCC57.3

Abbreviations: BP, base pairs; TA, annealing temperature.

Immunofluorescence Labeling 

Injured and noninjured tibialis anterior muscles were harvested and snap frozen, as described above. Cryosections (cross-section, 10μm) were prepared, collected onto chrom-alum coated slides, incubated with 3% bovine serum albumin in PBS for 1 hour, and then labeled with antidystrophin antibodies, followed by fluoresceinated donkey anti-mouse immunoglobulin G,n as described.11 Tissue sections were washed and mounted in Vectashield.o Digital images were obtained with a Zeiss 410 confocal laser-scanning microscopei and assembled with CorelDraw.p

Injection of Evans Blue Dye 

One day before injury or control treatments, the rats received an intraperitoneal injection of 1% (wt/vol) Evans blue dyeq in PBS at a volume of 1% body mass (1mg of Evans blue dye/0.1mL of PBS/10g of body mass). This solution was sterilized by passage through a Millex-GP 0.22μm filter.r The presence of Evans blue dye does not interfere with normal muscle function or recovery after injury (data not shown).

Muscles of animals injected with Evans blue dye were collected as described above and the presence of Evans blue dye was assessed under confocal optics at 568nm. To determine the number of Evans blue dye−positive fibers, at least 4 sections from every control and injured muscle were examined. We administered equal amounts of Evans blue dye per body weight and maintained identical optical settings during all confocal microscopy. Cells were counted as Evans blue dye positive if the fluorescent intensity was at least 50% of the signal intensity of the brightest region of the labeling in the extracellular space. With an average of 47±12 fibers/field, almost 600 fibers from 3 different animals were counted at each time point to determine the presence of Evans blue dye. In most experiments, samples labeled with Evans blue dye were also labeled for dystrophin by immunofluorescence (see above).

Statistical Analysis 

Contractile data were analyzed using a 2-factor analysis of variance (ANOVA),s with irradiation and time as the independent variables, and percentage of control force as the dependent variable. Cell counts from light and fluorescent micrographs were analyzed with a 1-way ANOVA. We performed a Tukey post hoc analysis to determine significant differences. Significance was set at P less than .05 and all results are reported as mean ± standard deviation (SD).

Back to Article Outline

Results 

Despite very different muscle strain protocols, 1R and MR both resulted in similar force deficits (≈40%), thus permitting the study of differences in the process of recovery from each without concern for differences in the extent of injury. To determine the effects of irradiation on recovery, we assessed the loss and recovery of tibialis anterior muscle function over a 3-week period after the injury by measuring maximal tetanic tension (P0). P0 is a strong indicator of the overall status of a muscle23 and a reliable indicator of injury.17, 18 Control data were obtained from the uninjured tibialis anterior of the opposite hindlimb.

Effects of Gamma Irradiation on Functional Recovery 

Compared with controls (P0=8.68±1.04N), P0 in tibialis anterior muscles from animals that were injured using the MR protocol decreased significantly on the day of injury (41% force deficit at day 0) and continued to decline at day 3 and day 7, at which times it remained significantly different from P0 in noninjured controls (fig 2). Force recovered thereafter and returned to normative values over the next 1 to 2 weeks, such that by day 14 there was no significant difference from the controls. Tibialis anterior muscles irradiated before injury had a similar, statistically significant loss of force on day 0 (46% force deficit) and had further losses on days 3 and 7 (see fig 2). In the 3-week period that we studied them, irradiated muscles failed to recover normally: 3 weeks after injury they still showed a significant force deficit of 35%. Additional controls showed that irradiation alone had no effect on the contractile function of uninjured muscle over the 3-week period we studied (see fig 1), nor did it alter overall growth of the animals, as indicated by body weight (table 2).

  • View full-size image.
  • Fig 2. 

    Irradiation inhibits recovery after small strain MR injury, but not after large strain 1R injury. Maximal tetanic tension was measured from uninjured () and injured tibialis anterior muscles on the day of injury (day 0) and at days 3, 7, 14, and 21 after injury (●) to determine the recovery seen in tibialis anterior muscles that were injured (A) by multiple repetitions or (B) by a single repetition. To determine whether myogenic cell proliferation was necessary for recovery, maximal tetanic tension was measured at the same time points in tibialis anterior muscles that were irradiated before injury (▾). To confirm that the radiation dose used in this study did not have a detrimental effect on function, tibialis anterior muscles from a third group of animals received irradiation only (○). The results show that irradiation inhibits recovery after MR, but not after 1R injury (n=5 animals tested at all time points). *Significant difference in value from uninjured within groups (P<.05); significant difference in value from injured, but not irradiated.

Table 2. Body Weights and Muscle Weights
WeightInjury Group (n=50)Injury + Irradiation Group (n=50)
Day 0Day 3Day 7Day 14Day 21Day 0Day 3Day 7Day 14Day 21
Initial BW (g)385±7397±11386±19390±10387±9382±14389±11387±16386±8398±12
Final BW (g)NA409±14431±13463±6484±13NA401±10432±14464±9500±13
Injured TA weight (mg)769±69817±41655±37700±54883±33685±42811±69699±12590±11642±13
Opposite TA (control) weight (mg)708±30720±30743±16735±35838±13685±29717±12734±7743±6773±16

NOTE. Values are mean ± SD. There were 5 animals at each of the 5 time points, and 2 of each group (MR and 1R Injury, MR and 1R Inj + Irradiation). The irradiation-only group is not included in this table. No significant differences were found in body weight between groups or in rate of growth between groups.

Abbreviations: BW, body weight; NA, not available; TA, tibialis anterior muscle.

Tibialis anterior muscles in hindlimbs subjected to the 1R protocol experienced a comparable amount of immediate injury (43% decrease in P0 at day 0), but they began to recover within 7 days (see fig 2). Muscles that had been irradiated before the 1R injury experienced a similar loss of contractile force initially (see fig 2) and then recovered complete contractile function with a time course indistinguishable from injured muscles that had not been irradiated.

Effectiveness of Gamma Irradiation 

We confirmed the effectiveness of the gamma-irradiation protocol on the myogenic response by studying tibialis anterior muscles injected with cardiotoxin. Cardiotoxin induces extensive muscle degeneration, which is followed by regeneration through proliferation of myogenic cells.21, 24, 25 BrdU is a thymidine analogue that is incorporated into the DNA of replicating cells. After cardiotoxin injection (see Methods), the number of nuclei with BrdU uptake increased significantly 3 days after cardiotoxin injection (29% of nuclei were labeled), but was dramatically reduced in muscles that had been irradiated (0%). The number of centrally nucleated fibers peaked 14 days after cardiotoxin injection (40%), which was significantly different from controls (P<.05), but there were no centrally nucleated fibers detectable after irradiation (0%). Thus, our irradiation protocol disrupts mitotic activity (BrdU uptake) and the formation of newly formed muscle fibers, indicated by the presence of central nuclei. This inhibition of myogenic cell proliferation by irradiation is in agreement with previous reports.1, 19, 20, 21

Effects of Irradiation on Centrally Nucleated Fibers and Messenger RNA After Injury 

We counted centrally nucleated fibers to assess the contribution of the myogenic response to irradiated and unirradiated tibialis anterior muscles recovering from 1R and MR protocols. Centrally nucleated fibers did not increase significantly at any time after the 1R injury, compared with controls, whether or not they were irradiated before injury (fig 3A). The MR injury protocol resulted in the appearance of centrally nucleated fibers on day 7 and a marked increase on day 14, most of which were lost over the following week (fig 3B). Irradiation of muscles before the MR injury completely eliminated the appearance of centrally nucleated fibers over the following 3 weeks (see fig 3B).

  • View full-size image.
  • Fig 3. 

    Centrally nucleated fibers (CNFs) increase after the MR protocol and are absent after irradiation. Sections from each muscle were stained with hematoxylin and eosin to determine the presence of centrally nucleated fibers. (A) An increase in centrally nucleated fibers was only seen after the MR injury protocol, and was especially prominent at 14 days after the injury. (B) This increase on day 14 was completely eradicated in muscles that were irradiated before injury (MR + Irr). *Significant difference in value from uninjured (P<.05).

The messenger RNA (mRNA) for myoD, a muscle-specific transcription factor, was present in controls and increased on days 3 and 7 after the MR protocol (fig 4). A much smaller increase in the myoD PCR product was detected after the 1R injury. The mRNA encoding myogenin, another muscle-specific transcription factor, gave similar results. Increases in both mRNAs were nearly completely inhibited by irradiation before injury (see fig 4), although a very faint band for myogenin persisted in irradiated muscles at day 21 after the MR injury.

  • View full-size image.
  • Fig 4. 

    Irradiation inhibits expression of myogenic markers after injury. The mRNA encoding myoD and myogenin were assayed in extracts of tibialis anterior muscle by RT-PCR at different times (3, 7, 14, and 21 days) after MR or 1R injury, with or without irradiation. Levels of both transcripts increased after MR injury and this increase was inhibited by irradiation. Smaller increases were seen after 1R injury and were similarly inhibited by irradiation. GAPDH was used as a loading control. Results confirm that irradiation effectively inhibits the proliferation of myogenic cells after injury.

Labeling With Evans Blue Dye and Antibodies 

Evans blue dye only enters fibers that sustain sarcolemmal damage as a result of disease or injury.26 We injected Evans blue dye into rats 24 hours before inducing injury to test whether injured muscle fibers that took up the dye disappeared as a function of time after injury, or if the dye persisted over the period in which recovery occurred (fig 5). After the 1R protocol, the number of Evans blue dye−positive fibers (30%) was not significantly different 1 week after injury (28%) (fig 6). These findings support the idea that membrane resealing occurs after a contraction-induced injury from a single acute lengthening contraction. Although the number of Evans blue dye−positive fibers was even higher in the MR protocol on day 0 (46%) (see fig 6), the number of Evans blue dye−positive fibers gradually diminished over time (36% on day 3, 10% on day 7).

  • View full-size image.
  • Fig 5. 

    Labeling of myofibers by Evans blue dye and antibodies to dystrophin. Rats were injected with Evans blue dye and subjected to MR or 1R injury 1 day later. Frozen cross-sections were collected on the day of injury (day 0) and 7 days later, and labeled with antidystrophin antibodies and fluoresceinated secondary antibodies. Sections were examined for the presence of intracellular Evans blue dye and dystrophin at the sarcolemma. The results show that myofibers injured by the 1R protocol (eg, white arrows) retain Evans blue dye for at least 1 week after the injury, and that dystrophin that is lost immediately after injury recovers over the next week, even in fibers that still retain Evans blue dye. Evans blue dye clearly labeled fibers after the MR injury, however, Evans blue dye−positive fibers did not persist over time (lower panels). NOTE. Scale bar is 50μm.

  • View full-size image.
  • Fig 6. 

    Quantitation of myofibers labeled by Evans blue dye (EBD) and antidystrophin after MR and 1R injuries. The results of the studies illustrated in figure 5 were quantitated. (A) The results show that the number of fibers labeled by Evans blue dye after MR injury returns to near control levels during the week after injury, and compared with the 1R injury, fewer fibers lose dystrophin over this period. (B) By contrast, the number of fibers labeled by Evans blue dye after 1R injury remains constant, even as the number of fibers that fail to label for dystrophin return to control levels. *Significant difference in value from uninjured within groups (P<.05); significant difference in value from fibers lacking dystrophin group.

We also monitored the presence of dystrophin, which is lost from fibers injured by the 1R protocol.11 Immunolabeling of injured muscles with antidystrophin antibodies confirmed the loss of dystrophin from the sarcolemma immediately after injury (26%) (see Fig 5, Fig 6). Three days after 1R injury, Evans blue dye−labeled fibers showed partial restoration of dystrophin (16%), and within a week (5%), dystrophin was nearly completely restored to fibers that retained Evans blue dye. Immediately after the MR protocol, only about half as many fiber had a loss of labeling for dystrophin at the sarcolemma (13%) (see Fig 5, Fig 6), which suggests that the nature of the damage to the sarcolemma caused by MR and 1R protocols differed substantially.

Back to Article Outline

Discussion 

Proliferation of myogenic cells in adult skeletal muscle is presumed to be a prerequisite for the recovery of function after injury,27 but given the differences among injury protocols, it seems likely that the myogenic response may not be essential for recovery from all types of injury. We addressed this question by irradiating muscles before injuring them with 2 different protocols for contraction-induced injury that had different biomechanic features, but that led to a similar loss of contractile function.1, 12 Recovery of muscle after injury by the MR protocol has already been shown to require proliferation of myogenic cells,1 which can be effectively blunted by gamma irradiation. We confirm that full recovery after multiple lengthening contractions requires a myogenic response and we report for the first time in the literature that recovery from a single contraction-induced injury does not.

The similar loss of contractile function after each of the protocols we used was the result of different biomechanic perturbations—one that causes injury by repeated lengthening contractions using a small strain, and the other by a single lengthening contraction using a large strain. We therefore expected to induce different mechanisms of recovery. The efficacy of our irradiation method in preventing proliferation of myogenic cells was key to the interpretation of our results. We tested this rigorously in muscle treated with cardiotoxin, which causes massive degeneration and regeneration of skeletal muscle21, 24, 25 and found that irradiation completely inhibited the formation of new skeletal myofibers by 2 measures: incorporation of BrdU into myonuclei and the appearance of centrally nucleated fibers.

By every measure, the MR injury protocol induced proliferation of myogenic cells. Myogenic markers were sharply elevated after MR injury. Likewise, the number of centrally nucleated fibers increased greatly after MR injury, consistent with the generation of new muscle fibers.28 The appearance of centrally nucleated fibers peaked at approximately 2 weeks after the MR protocol and dropped thereafter, suggesting that most of the newly formed, centrally nucleated muscle fibers were transformed into more mature fibers (with myonuclei located at the cell periphery, not centrally) over the following week. Such a transient peak in centrally nucleated fibers in the days after muscle injury has also been observed by others.29 Applying our irradiation protocol to muscle immediately before MR blocked the appearance of centrally nucleated fibers after the MR injury (see fig 3), suppressed the expression of 2 myogenic markers—myoD and myogenin (see fig 4)—and attenuated functional recovery. This is consistent with previous reports1, 19, 20, 30, 31 that show local gamma irradiation of muscle before repeated lengthening contractions prevents proliferation of myogenic cells and regeneration of skeletal muscle.

By contrast, recovery of contractile force after injury by a single, maximal lengthening contraction (1R) is independent of the myogenic response, by the same criteria. The mRNAs encoding myoD and myogenin are only slightly elevated after the 1R protocol, but even this meager increase was suppressed by irradiation. Centrally nucleated fibers did not increase after 1R, with or without irradiation before injury. Nonetheless, recovery of contractile force in irradiated, 1R-injured muscle was not impeded and was, in fact, identical to that in unirradiated, injured tibialis anterior muscles.

Although myoD and myogenin are expressed specifically in myogenic cells32 and are down-regulated after muscle fibers form, they are expressed at low levels in mature myofibers.28 Their slight elevation after the 1R protocol may be part of the normal response of mature muscle to damage associated with injury.13, 33 Alternatively, they may increase slightly because of the persistence of radiation-resistant stem cells within the muscle.34 If these confounding factors contributed to our results, their effects were clearly minimal.

Our 1R and MR protocols for injuring tibialis anterior muscles were based on established methods1, 11, 12 and were designed to induce a similar amount of force loss and comparable period for full recovery. Thus, the differences in the role of myogenic cell proliferation in the recovery after these 2 protocols could not simply be ascribed to quantitative differences in the extent or timing of the injury or the recovery period.

The fact that recovery from 1R injury occurs without a detectable contribution of myogenic cell proliferation indicates that other mechanisms must predominate. Our data suggest that 1 contributing mechanism is the ability of the sarcolemma to reseal shortly after 1R injury. Disruption and repair of the plasma membrane is a normal physiologic process that occurs in many cell types,35 including skeletal muscle.36, 37 The sarcolemma is clearly breached by the 1R injury protocol, as indicated by Evans blue dye labeling of the myoplasm and a loss of dystrophin11 (see also fig 5). Remarkably, however, damaged myofibers recovering from the 1R protocol retain Evans blue dye. This suggests that the sarcolemma becomes impermeable to the dye shortly after the injury and that the damaged areas of the membrane are therefore “resealed.” Consistent with this assumption, dystrophin is gradually restored in fibers that were damaged during the 1R protocol and that remain labeled with Evans blue dye. Resealing is likely to require proteins such as dysferlin and myoferlin, which have been shown to promote membrane repair after other forms of injury.38, 39

By contrast, most of the intracellular Evans blue dye label was lost over the recovery period after the MR protocol, consistent with the loss of the fibers that sustained damage to their sarcolemma during the repetitive injury. We propose that the majority of these injured fibers were replaced by myogenesis. The ability of irradiation administered before the MR protocol to inhibit 50% to 60% of the recovery of contractile function is consistent with this interpretation. The residual amount of recovery that occurs in these irradiated muscles may be explained by the survival and recovery of some of the fibers injured by MR (10% of the injured fibers in these muscles are likely to have survived the first week after injury, as indicated by their retention of Evans blue dye) (see fig 6). Alternatively, the residual recovery may result from the expansion of a few radiation-resistant stem cells within the muscle,34 or the repair by polymerases of irradiation-induced DNA breaks.40

Skeletal muscle regeneration can be induced by various types of treatments or injury, such as injection of myotoxins,41, 42, 43 laceration,44 crush or thermal injury,2, 45, 46 and repeated contractions or bouts of intensive exercise.47, 48, 49, 50 Myogenesis, mediated primarily by the expansion of muscle satellite cells, has an important role in the recovery from most of these injuries,1, 41, 51, 52, 53 but the degree, amplitude, and nature of the regenerative response likely depends on the nature and extent of the injury, 2, 28 as well as on the specific muscle54 and the animal species studied.47, 55

Back to Article Outline

Conclusions 

Our results indicate that recovery from acute muscle injuries can occur without significant levels of myogenic cell proliferation. Such findings suggest that the mechanisms that underlie the recovery of force after injuries caused by repeated contractions and those caused by a single acute contraction may differ in ways that may be important in devising targeted therapeutic strategies for each. For example, Tidball33 indicated that inflammation can be harmful to the muscle cell membrane, but more recent findings by Tidball and Wehling-Henricks56 suggest this may not be so. Furthermore, inflammation may actually facilitate myogenesis.57, 58 It will be interesting to learn whether the use of nonsteroidal anti-inflammatory drugs, commonly used to treat muscle injuries, has a beneficial effect on mechanisms involving the regeneration of myofibers through the proliferation and fusion of satellite cells, the resealing of damaged sarcolemma, or both.59

Supplier

Back to Article Outline

References 

  1. Rathbone CR, Wenke JC, Warren GL, Armstrong RB. Importance of satellite cells in the strength recovery after eccentric contraction-induced muscle injury. Am J Physiol Regul Integr Comp Physiol. 2003;285:R1490–R1495
  2. Lefaucheur JP, Sebille A. The cellular events of injured muscle regeneration depend on the nature of the injury. Neuromuscul Disord. 1995;5:501–509
  3. Aarimaa V, Rantanen J, Best T, Schultz E, Corr D, Kalimo H. Mild eccentric stretch injury in skeletal muscle causes transient effects on tensile load and cell proliferation. Scand J Med Sci Sports. 2004;14:367–372
  4. Hameed M, Orrell RW, Cobbold M, Goldspink G, Harridge SD. Expression of IGF-I splice variants in young and old human skeletal muscle after high resistance exercise. J Physiol. 2003;547:247–254
  5. Linderman JK, Gosselink KL, Booth FW, Mukku VR, Grindeland RE. Resistance exercise and growth hormone as countermeasures for skeletal muscle atrophy in hindlimb-suspended rats. Am J Physiol. 1994;267:R365–R371
  6. Yan Z, Biggs RB, Booth FW. Insulin-like growth factor immunoreactivity increases in muscle after acute eccentric contractions. J Appl Physiol. 1993;74:410–414
  7. Hill M, Wernig A, Goldspink G. Muscle satellite (stem) cell activation during local tissue injury and repair. J Anat. 2003;203:89–99
  8. Lieber RL, Thornell LE, Friden J. Muscle cytoskeletal disruption occurs within the first 15 min of cyclic eccentric contraction. J Appl Physiol. 1996;80:278–284
  9. Nosaka K, Sakamoto K, Newton M, Sacco P. The repeated bout effect of reduced-load eccentric exercise on elbow flexor muscle damage. Eur J Appl Physiol. 2001;85:34–40
  10. Pizza FX, Peterson JM, Baas JH, Koh TJ. Neutrophils contribute to muscle injury and impair its resolution after lengthening contractions in mice. J Physiol. 2005;562:899–913
  11. Lovering RM, De Deyne PG. Contractile function, sarcolemma integrity, and the loss of dystrophin after skeletal muscle eccentric contraction-induced injury. Am J Physiol Cell Physiol. 2004;286:C230–C238
  12. Lovering RM, Hakim M, Moorman CT, De Deyne PG. The contribution of contractile pre-activation to loss of function after a single lengthening contraction. J Biomech. 2005;38:1501–1507
  13. Hakim M, Hage W, Lovering RM, Moorman CT, Curl LA, De Deyne PG. Dexamethasone and recovery of contractile tension after a muscle injury. Clin Orthop Relat Res. 2005;439:235–242Oct
  14. MacIntyre DL, Reid WD, Lyster DM, McKenzie DC. Different effects of strenuous eccentric exercise on the accumulation of neutrophils in muscle in women and men. Eur J Appl Physiol. 2000;81:47–53
  15. MacIntyre DL, Reid WD, Lyster DM, Szasz IJ, McKenzie DC. Presence of WBC, decreased strength, and delayed soreness in muscle after eccentric exercise. J Appl Physiol. 1996;80:1006–1013
  16. Warren GL, Ingalls CP, Lowe DA, Armstrong RB. What mechanisms contribute to the strength loss that occurs during and in the recovery from skeletal muscle injury?. J Orthop Sports Phys Ther. 2002;32:58–64
  17. Faulkner JA, Brooks SV, Opiteck JA. Injury to skeletal muscle fibers during contractions: conditions of occurrence and prevention. Phys Ther. 1993;73:911–921
  18. Warren GL, Lowe DA, Armstrong RB. Measurement tools used in the study of eccentric contraction-induced injury. Sports Med. 1999;27:43–59
  19. Adams GR, Caiozzo VJ, Haddad F, Baldwin KM. Cellular and molecular responses to increased skeletal muscle loading after irradiation. Am J Physiol Cell Physiol. 2002;283:C1182–C1195
  20. Martins KJ, Gordon T, Pette D, et al. Effect of satellite cell ablation on low-frequency stimulated fast-to-slow fibre type transitions in rat skeletal muscle. J Physiol. 2006;572(Pt 1):281–294
  21. Yan Z, Choi S, Liu X, et al. Highly coordinated gene regulation in mouse skeletal muscle regeneration. J Biol Chem. 2003;278:8826–8836
  22. Chomczynski P, Sacchi N. Single-step method of RNA isolation by acid guanidinium thiocyanate-phenol-chloroform extraction. Anal Biochem. 1987;162:156–159
  23. Brooks SV, Zerba E, Faulkner JA. Injury to muscle fibres after single stretches of passive and maximally stimulated muscles in mice. J Physiol. 1995;488(Pt 2):459–469
  24. Hawke TJ, Garry DJ. Myogenic satellite cells: physiology to molecular biology. J Appl Physiol. 2001;91:534–551
  25. Garry DJ, Yang Q, Bassel-Duby R, Williams RS. Persistent expression of MNF identifies myogenic stem cells in postnatal muscles. Dev Biol. 1997;188:280–294
  26. Hamer PW, McGeachie JM, Davies MJ, Grounds MD. Evans Blue Dye as an in vivo marker of myofibre damage: optimising parameters for detecting initial myofibre membrane permeability. J Anat. 2002;200:69–79
  27. Irintchev A, Langer M, Zweyer M, Theisen R, Wernig A. Functional improvement of damaged adult mouse muscle by implantation of primary myoblasts. J Physiol. 1997;500(Pt 3):775–785
  28. Charge SB, Rudnicki MA. Cellular and molecular regulation of muscle regeneration. Physiol Rev. 2004;84:209–238
  29. Fisher BD, Baracos VE, Shnitka TK, Mendryk SW, Reid DC. Ultrastructural events following acute muscle trauma. Med Sci Sports Exerc. 1990;22:185–193
  30. Rosenblatt JD, Yong D, Parry DJ. Satellite cell activity is required for hypertrophy of overloaded adult rat muscle. Muscle Nerve. 1994;17:608–613
  31. Rosenblatt JD, Parry DJ. Adaptation of rat extensor digitorum longus muscle to gamma irradiation and overload. Pflugers Arch. 1993;423:255–264
  32. Best TM, Hunter KD. Muscle injury and repair. Phys Med Rehabil Clin N Am. 2000;11:251–266
  33. Tidball JG. Inflammatory processes in muscle injury and repair. Am J Physiol Regul Integr Comp Physiol. 2005;288:R345–R353
  34. Heslop L, Morgan JE, Partridge TA. Evidence for a myogenic stem cell that is exhausted in dystrophic muscle. J Cell Sci. 2000;113(Pt 12):2299–2308
  35. McNeil PL, Terasaki M. Coping with the inevitable: how cells repair a torn surface membrane. Nat Cell Biol. 2001;3:E124–E129
  36. Papadimitriou JM, Robertson TA, Mitchell CA, Grounds MD. The process of new plasmalemma formation in focally injured skeletal muscle fibers. J Struct Biol. 1990;103:124–134
  37. Bansal D, Miyake K, Vogel SS, et al. Defective membrane repair in dysferlin-deficient muscular dystrophy. Nature. 2003;423:168–172
  38. Lennon NJ, Kho A, Bacskai BJ, Perlmutter SL, Hyman BT, Brown RH. Dysferlin interacts with annexins A1 and A2 and mediates sarcolemmal wound-healing. J Biol Chem. 2003;278:50466–50473
  39. Doherty KR, McNally EM. Repairing the tears: dysferlin in muscle membrane repair. Trends Mol Med. 2003;9:327–330
  40. Mozdziak PE, Schultz E, Cassens RG. The effect of in vivo and in vitro irradiation (25 Gy) on the subsequent in vitro growth of satellite cells. Cell Tissue Res. 1996;283:203–208
  41. d’Albis A, Couteaux R, Janmot C, Roulet A, Mira JC. Regeneration after cardiotoxin injury of innervated and denervated slow and fast muscles of mammals (Myosin isoform analysis). Eur J Biochem. 1988;174:103–110
  42. Harris JB, Johnson MA. Further observations on the pathological responses of rat skeletal muscle to toxins isolated from the venom of the Australian tiger snake, Notechis scutatus scutatus. Clin Exp Pharmacol Physiol. 1978;5:587–600
  43. Hall-Craggs EC, Seyan HS. Histochemical changes in innervated and denervated skeletal muscle fibers following treatment with bupivacaine (marcain). Exp Neurol. 1975;46:345–354
  44. Fukushima K, Badlani N, Usas A, Riano F, Fu F, Huard J. The use of an antifibrosis agent to improve muscle recovery after laceration. Am J Sports Med. 2001;29:394–402
  45. Schultz E, Jaryszak DL, Valliere CR. Response of satellite cells to focal skeletal muscle injury. Muscle Nerve. 1985;8:217–222
  46. Hurme T, Kalimo H. Activation of myogenic precursor cells after muscle injury. Med Sci Sports Exerc. 1992;24:197–205
  47. Irintchev A, Wernig A. Muscle damage and repair in voluntarily running mice: strain and muscle differences. Cell Tissue Res. 1987;249:509–521
  48. McCully KK, Faulkner JA. Injury to skeletal muscle fibers of mice following lengthening contractions. J Appl Physiol. 1985;59:119–126
  49. Appell HJ, Forsberg S, Hollmann W. Satellite cell activation in human skeletal muscle after training: evidence for muscle fiber neoformation. Int J Sports Med. 1988;9:297–299
  50. Vierck J, O’Reilly B, Hossner K, et al. Satellite cell regulation following myotrauma caused by resistance exercise. Cell Biol Int. 2000;24:263–272
  51. Garry DJ, Meeson A, Elterman J, et al. Myogenic stem cell function is impaired in mice lacking the forkhead/winged helix protein MNF. Proc Natl Acad Sci U S A. 2000;97:5416–5421
  52. Creuzet S, Lescaudron L, Li Z, Fontaine-Perus J. MyoD, myogenin, and desmin-nls-lacZ transgene emphasize the distinct patterns of satellite cell activation in growth and regeneration. Exp Cell Res. 1998;243:241–253
  53. Kurek JB, Bower JJ, Romanella M, Koentgen F, Murphy M, Austin L. The role of leukemia inhibitory factor in skeletal muscle regeneration. Muscle Nerve. 1997;20:815–822
  54. Pavlath GK, Thaloor D, Rando TA, Cheong M, English AW, Zheng B. Heterogeneity among muscle precursor cells in adult skeletal muscles with differing regenerative capacities. Dev Dyn. 1998;212:495–508
  55. Mitchell CA, McGeachie JK, Grounds MD. Cellular differences in the regeneration of murine skeletal muscle: a quantitative histological study in SJL/J and BALB/c mice. Cell Tissue Res. 1992;269:159–166
  56. Tidball JG, Wehling-Henricks M. Macrophages promote muscle membrane repair and muscle fibre growth and regeneration during modified muscle loading in mice in vivo. J Physiol. 2007;578:327–336
  57. Bondesen BA, Mills ST, Kegley KM, Pavlath GK. The COX-2 pathway is essential during early stages of skeletal muscle regeneration. Am J Physiol Cell Physiol. 2004;287:C475–C483
  58. Mendias CL, Tatsumi R, Allen RE. Role of cyclooxygenase-1 and -2 in satellite cell proliferation, differentiation, and fusion. Muscle Nerve. 2004;30:497–500
  59. Toumi H, Best TM. The inflammatory response: friend or enemy for muscle injury?. Br J Sports Med. 2003;37:284–286
  • a Charles River Laboratories, 251 Ballardvale St, Wilmington, MA 01887-1000.
  • b Model T8904; NMB Technologies, 9730 Independence Ave, Chatsworth, CA 91311.
  • c LabView version 4.1; National Instruments, 11500 N Mopac Expwy, Austin, TX 78759-3504.
  • d Harvard Apparatus, 84 October Hill Rd, Holliston, MA 01746.
  • e Grass Instruments, Astro-Med Industrial Park, 600 E Greenwich Ave, West Warwick, RI 02893.
  • f Bipolar series model HF 320; Pantak-Seifert GmbH & Co, Bogenstrasse 41, 22926 Ahrensburg, Germany
  • g Model 31006; PTW-Freiburg, Lörracher Strasse 7, 79115 Freiburg, Germany.
  • h Kite Manipulator; World Precision Instruments Inc, 175 Sarasota Center Blvd, Sarasota, FL 34240.
  • i Carl Zeiss AG, 07740 Jena, Germany.
  • j Invitrogen Corp, 1600 Faraday Ave, PO Box 6482, Carlsbad, CA 92008.
  • k Applied Biosystems, 850 Lincoln Centre Dr, Foster City, CA 94404.
  • l Model ES-120; Kodak, 1700 Dewey Ave, Rochester, NY 14650-1910.
  • m Oxford Molecular Ltd, Accelrys Ltd, 334 Cambridge Science Pk, Cambridge, CB4 0WN, UK.
  • n Jackson ImmunoResearch Laboratories, PO Box 9, 872 West Baltimore Pike, West Grove, PA 19390.
  • o Vector Laboratories, 30 Ingold Rd, Burlingame, CA 94010.
  • p CorelDraw; Corel Corp, 1600 Carling Ave, Ottawa, ON, K1Z 8R7, Canada.
  • q Sigma-Aldrich, 3050 Spruce St, St. Louis, MO 63103.
  • r Millipore, 290 Concord Rd, Billerica, MA 01821.
  • s SigmaStat; Systat Software Inc, 1735 Technology Dr, Ste 430, San Jose, CA 95110.

 Supported in part by the University of Maryland Muscle Biology Training Program, National Institutes of Health (grant nos. T32 AR07592, F32 HD047099-02, K01 HD 01165), the Muscular Dystrophy Association, and the National Football League Charities.

 No commercial party having a direct financial interest in the results of the research supporting this article has or will confer a benefit upon the author(s) or upon any organization with which the author(s) is/are associated.

PII: S0003-9993(07)00107-4

doi:10.1016/j.apmr.2007.02.010

Archives of Physical Medicine and Rehabilitation
Volume 88, Issue 5 , Pages 617-625, May 2007