Archives of Physical Medicine and Rehabilitation
Volume 87, Issue 2 , Pages 241-246, February 2006

The Effect of 30 Minutes of Passive Stretch of the Rat Soleus Muscle on the Myogenic Differentiation, Myostatin, and Atrogin-1 Gene Expressions

Presented as abstracts to the Federação de Sociedades de Biologia Experimental, August 25–28, 2004, Águas de Lindóia, Brazil, and the American Physiological Society, October 6–9, 2004, Austin, TX.

  • Anna R. Gomes, PT, MS, PhD

      Affiliations

    • Unit of Skeletal Muscle Plasticity, Department of Physical Therapy, Federal University of São Carlos, São Carlos, SP, Brazil
    • ,
  • Antonio G. Soares, TA

      Affiliations

    • Unit of Muscle Morphology, Biomedical Science Institute I, Department of Cell and Developmental Biology, University of São Paulo, São Paulo, SP, Brazil
    • ,
  • Sabrina Peviani, PT, MS

      Affiliations

    • Unit of Skeletal Muscle Plasticity, Department of Physical Therapy, Federal University of São Carlos, São Carlos, SP, Brazil
    • ,
  • Rubia B. Nascimento, PT

      Affiliations

    • Unit of Skeletal Muscle Plasticity, Department of Physical Therapy, Federal University of São Carlos, São Carlos, SP, Brazil
    • ,
  • Anselmo S. Moriscot, PT, MS, PhD

      Affiliations

    • Unit of Muscle Morphology, Biomedical Science Institute I, Department of Cell and Developmental Biology, University of São Paulo, São Paulo, SP, Brazil
    • ,
  • Tania F. Salvini, PT, MS, PhD

      Affiliations

    • Unit of Skeletal Muscle Plasticity, Department of Physical Therapy, Federal University of São Carlos, São Carlos, SP, Brazil
    • Corresponding Author InformationReprint requests to Tania F. Salvini, PT, MS, PhD, Departamento de Fisioterapia, Universidade Federal de São Carlos, CEP 13565-905 São Carlos, SP, Brasil

Article Outline

Abstract 

Gomes AR, Soares AG, Peviani S, Nascimento RB, Moriscot AS, Salvini TF. The effect of 30 minutes of passive stretch of the rat soleus muscle on the myogenic differentiation, myostatin, and atrogin-1 gene expressions.

Objective

To evaluate the effect of passive stretch, applied for 30 minutes to the rat soleus muscle, on the myogenic differentiation (myoD), myostatin, and atrogin-1 gene expressions.

Design

Case-controlled study.

Setting

University laboratory.

Animals

Fifty 12-week-old male Wistar rats.

Interventions

Six groups of animals were given a single stretch bout and were evaluated immediately and 8, 24, 48, 72, and 168 hours later. Another 3 groups were evaluated immediately after 2, 3, and 7 stretches. An intact control group was also analyzed.

Main Outcome Measures

The messenger ribonucleic acid (mRNA) levels of myoD, myostatin, and atrogin-1 were assessed by real-time polymerase chain reaction.

Results

Twenty-four hours after a single session of stretch only, the myoD mRNA levels had increased compared with the control group, whereas an increase in the atrogin-1 expression was observed after 2, 3, and 7 stretches.

Conclusions

A single session of passive stretch increased the myoD gene expression, a factor related to muscle growth. Interestingly, daily stretches increased the atrogin-1 gene expression, a gene primarily associated with muscle atrophy. The results indicated that gene expression was responsive to the number of stretch sessions.

Key Words:  Atrogin-1 , Rats , Muscles , MyoD protein , Stretch , Rehabilitation

 

SEVERAL STUDIES1, 2, 3 HAVE DESCRIBED the importance of stretching to prevent connective tissue proliferation, muscle fiber atrophy, and the loss of serial sarcomeres in immobilized muscles resulting in the so-called longitudinal growth. It has also been reported that stretch stimulus increases both the length and diameter of skeletal muscle.4, 5, 6 Previous reports7 have shown that daily sessions of passive stretch applied for 30 minutes to the rat soleus muscle, immobilized in the shortened position for 3 weeks, were enough to prevent the loss of serial sarcomeres and to maintain the joint range of motion. Also, it was recently shown that stretch sessions applied 3 times a week for 40 minutes to the soleus muscle of adult rats induced an increase in both the number of serial sarcomeres and the cross-sectional area (CSA), indicating an important hypertrophic effect.8 The molecular mechanisms and the intracellular pathways involved in longitudinal growth are still largely unknown, although it is well established that insulin-like growth factor (IGF) and mechano growth factor are highly expressed in skeletal muscle submitted to stretch.2, 3, 9, 10 Also, the expression pattern of muscle-specific target genes related to stretch remains elusive.

Because hypertrophy of skeletal muscle involves an increased rate of synthesis and accumulation of proteins, an increased transcription of muscle-specific genes is therefore necessary. Nevertheless, the mechanism by which nuclei increase transcription of specific skeletal muscle messenger ribonucleic acid (mRNA) in response to a hypertrophic stimulus is not known. It has been suggested that myogenic regulatory factors (MRFs) are involved in this mechanism.11

MRFs are a family of skeletal muscle-specific transcription factors that control the expression of several muscle genes. The family is composed of 4 members: myogenic differentiation (myoD), myogenic factor 5, myogenin, and myogenic regulatory factor 4 (MRF4).12 During embryogenesis, MRFs are critical in the establishment of the myogenic lineage and in controlling terminal differentiation of the myoblasts and myofibers.12, 13 It has already been reported that MRFs are upregulated in skeletal muscle hypertrophy induced by stretch.11, 14, 15, 16, 17, 18 The present study focused on investigating the myoD gene expression in skeletal muscle submitted to stretch, because of its role in the mechanism of muscle hypertrophy and also because MRFs respond to passive stretch according to time, age, and muscle type.11, 14, 19, 20, 21, 22, 23 Lowe et al11 found increased myoD gene expression in muscles maintained in a lengthened position for 6, 24, and 72 hours. Zador et al17 also identified an increase in the myoD mRNA level after 3 days of stretching. However, no detailed description is available on the expression of MRF genes in the temporal course after a short time of stretching, for example, 30 minutes.

In addition to the myoD factor investigation, the effect of muscle stretch on myostatin, also known as growth differentiating factor 8, a member of the transforming growth factor β superfamily,24 was also analyzed. There is strong experimental evidence pointing to a role of myostatin in repressing skeletal muscle growth.24 Accordingly, increases in myostatin levels during periods of muscle inactivity have been reported,25, 26 whereas myostatin expression seems to reduce on muscle reloading.27 Moreover, the blockage and subsequent inhibition of serum myostatin increased total body mass, muscle mass, muscle size, and absolute muscle strength.28, 29 Although, it is reasonable to assume that physical activity would probably decrease the expression of myostatin, 2 recent reports described an increase in the transcript levels of myostatin on muscles submitted to eccentric training in both rats30 and humans.31 However, to our knowledge, the effect of passive stretch on the myostatin gene expression in skeletal muscle has still not been investigated.

Although muscle stretch has been known as a hypertrophic stimulus,2 curiously, some reports also describe a decrease in the CSA of the rat soleus muscle submitted to stretch.32, 33 Therefore, it is reasonable to hypothesize that trophism-related genes are regulated during stretch. Furthermore, it would be interesting to investigate the effect of stretch on genes related to atrophy.

Atrogin-1 is a gene strongly activated in atrophying muscles from different etiologies such as immobilization, hindlimb suspension, chronic renal failure, diabetes, cancer cachexia, and denervation.34, 35 Atrogin-1, also called muscle atrophy F-box protein, is an F-box protein that links the protein substrate to be ubiquitinated and degraded with the rest of the E3 and ubiquitination machinery.36, 37 So atrogin-1 can be considered as a good candidate to study possible muscle atrophy associated with passive stretch.

The models developed to investigate the effect of stretch on skeletal muscle plasticity frequently use chronic passive stretch, applying immobilization using a plaster cast.38, 39, 40 Nevertheless, to our knowledge, only 2 articles have reported on the effect of repetitive stretch on the gene expression in muscle tissues from rats. The first showed a significant increase in the expression of myogenin in soleus muscle submitted to repetitive stretch, 15 times a minute for 4 hours,41 and the second reported an increase in myogenin gene expression in soleus muscle submitted to repetitive stretch for 60 minutes.42 Normally, in rehabilitation and sports medicine, muscle stretching is performed for short periods of time and its application is usually made passively, as in paralyzed and unconscious patients. Therefore, the aim of the present work was to determine the effect of daily sessions of passive stretch applied for short periods of time (30min) on the expression of 3 genes: myoD, related to muscle growth; myostatin, known as a negative regulator of muscle mass; and atrogin-1, a gene involved in muscle atrophy.

Back to Article Outline

Methods 

Animal Care and Experimental Groups 

We used 50 male, 3-month-old Wistar rats (weight, 373±32g). They were housed in plastic cages in a room with controlled environmental conditions and had free access to water and standard food. This study was conducted in accordance with the university approval for the care and use of laboratory animals. The rats were anesthetized by an intraperitoneal injection of xylazine (12mg/kg) and ketamine (95mg/kg) for the stretching of the soleus muscle and muscle dissection. Afterward, they were killed using an overdose of the anesthetic. To stretch the left soleus muscles, the left ankle was held in full dorsiflexion for 30 minutes by means of a piece of tape, as previously described by Williams.1

The animals were randomly divided into 10 groups of 5 animals each. Six groups received only a single session of stretching of the left soleus muscle for 30 consecutive minutes and were killed immediately after (n=5), and after 8 (n=5), 24 (n=5), 48 (n=5), 72 (n=5), and 168 (n=5) hours. To evaluate the effect of repetitive sessions of stretch on the soleus muscle, 3 groups of animals received daily 30-minutes session of stretch and the left soleus muscle was evaluated 24, 48, and 144 hours after the first session of stretch, and immediately after the last stretch. Thus the 24-hour group (n=5) received 2 stretches, the 48-hour group (n=5) received 3 stretches, and the 144-hour group (n=5) received 7 stretches. One group (n=5) of animals was not submitted to either procedure and the soleus was used as the control.

Each left soleus muscle of the rats was dissected, excised, and weighed. Afterward, the muscle was cut into 4 equal parts between the proximal and distal ends using a caliper. Each piece of muscle was immediately frozen in liquid nitrogen and stored at −80°C for the extraction of total RNA. Considering that there are conflicting reports in the literature regarding the distribution of the MRFs along the stretched muscle fibers,15, 17, 43, 44, 45 in the present study, we used only the ends of the soleus muscle for evaluation.

RNA Isolation and Analysis 

RNA was isolated from 1 frozen fragment from the distal ends of each muscle using 1mL of Trizol Reagenta according to the manufacturer’s instructions. The extracted RNA was dissolved in Tris-Cl and ethylenediaminetetraacetic acid and quantified spectrophotometrically. The integrity of the RNA was confirmed by usual inspection of ethidium bromide stained 18S and 28S ribosomal RNA under ultraviolet light.

Reverse Transcription 

One microgram of RNA was reverse transcribed using Superscript II reverse transcriptasea to synthesize complementary deoxyribonucleic acid (DNA). A reverse transcription reaction mixture (1μg of cellular RNA), 5× reverse transcription buffer, a deoxynucleotide triphosphates mixture containing 0.2mmol/L each of 2′-deoxyadenosine 5′-triphosphate, 2′-deoxycytidine 5′-triphosphate, and 2′-deoxyguanosine 5′-triphosphate, and 0.1mol/L of 2′-deoxythymidine 5′-triphosphate, 1μL of oligo (deoxythyminide) primer and 25U/μg of reverse transcriptase enzymea were incubated at 70°C for 10 minutes and at 42°C for 60 minutes, then heated at 95°C for 10 minutes and quick-chilled on ice.

Oligonucleotide Primers 

Oligonucleotide primers were designed for myostatin, atrogin, and transcription factor II D (TFIID) using the Primer Express Software.b Hill and Goldspink45 described myoD and synthesized them all using Imprint. The sequences used were from mouse TFIID (forward: CCACCAACTGCTTAGCACC; reverse, GCCAAATTCGTTGTCATACC); rat myoD (forward: GGAGACATCCTCAAGCGATGC; reverse, AGCACCTGGTAAATCGGATTG); rat myostatin (forward: AGTGACGGCTCTTTGGAAGATG; reverse, AGTCAGACTCGGTAGGCATGGT), and rat atrogin-1 (forward: TACTAAGGAGCGCCATGGATACT; reverse, GTTGAATCTTCTGGAATCCAGGAT) genes.

Analysis by Real-Time Polymerase Chain Reaction 

The RNA transcript levels for the different experimental and control muscles were analyzed simultaneously and the reactions carried out in duplicate in the Lightcycler (GeneAmp 5700 Sequence Detection Systemb) using fluorescent dye SYBR green detection.b

Statistics 

Statistical analyses were performed using the 1-way analysis of variance (ANOVA) and post hoc Tukey (significance set at P≤.05) to take into account the variation between the muscles of the control animals and variation between experimental groups.

Back to Article Outline

Results 

Muscle Mass 

No difference was found in the weight of the soleus muscles among any groups evaluated (table 1).

Table 1. Rat Soleus Muscle Weight
GroupsPeriod of EvaluationWeight (g)
Control .18±.03
Single stretchImmediately after.20±.01
8h.18±.02
24h.18±.02
48h.20±.02
72h.2±.01
168h.18±.02
Daily stretch24h (2 stretches).17±.01
48h (3 stretches).18±.01
144h (7 stretches).16±.01

NOTE. Values are mean ± standard deviation (n=5 per group).

MyoD Gene Expression 

An increase in the myoD gene expression was found 24 hours after a single session of stretch, when compared with the control group (3.4±0.9-fold vs 1±0.06-fold, respectively, ANOVA, P=.001; fig 1A). Subsequently, the myoD gene expression returned to the control levels for all the times evaluated (48h, 72h, 168h). On the other hand, when daily sessions of stretch were performed, the myoD levels remained unaltered for all periods evaluated (fig 1B).

  • View full-size image.
  • Fig 1. 

    The effect of 30 minutes of passive stretch on the mRNA myoD levels of the rat soleus muscle. (A) Soleus muscle submitted to a single session of stretch, evaluated immediately after (IA), and 8, 24, 48, 72, and 168 hours later. (B) Soleus muscle submitted to daily session of stretch and evaluated after 24 hours (received 2 stretches [2st]), 48 hours (received 3 stretches [3st]), and 144 hours (received 7 stretches [7st]). Values are mean ± standard deviation (SD). *P≤.005 (ANOVA), as compared with the control (Cont) group.

Myostatin Gene Expression 

The myostatin gene expression was not altered by any of the stretch periods tested (fig 2).

  • View full-size image.
  • Fig 2. 

    The effect of 30 minutes of passive stretch on the mRNA myostatin levels of the rat soleus muscle. (A) Soleus muscle submitted to a single session of stretch, evaluated immediately after (IA), and 8, 24, 48, 72, and 168 hours later. (B) Soleus muscle submitted to daily sessions of stretch and evaluated 24 hours (received 2 stretches), 48 hours (received 3 stretches), and 144 hours (received 7 stretches). Values are mean ± SD.

Atrogin-1 Gene Expression 

The atrogin-1 gene expression was not altered after a single session of stretch, when compared with the control group (fig 3A). However, in the groups submitted to daily sessions of stretch, an increase in the atrogin-1 gene expression (ANOVA, P≤.05) was found after 24 hours (2±0.4-fold; after 2 stretches), 48 hours (2.5±0.6-fold; after 3 stretches), and 144 hours (6±1-fold; after 7 stretches), when compared with the controls (fig 3B).

  • View full-size image.
  • Fig 3. 

    The effect of 30 minutes of passive stretch on the mRNA atrogin-1 levels of the rat soleus muscle. (A) Soleus muscle submitted to a single session of stretch, evaluated immediately after (IA), and 8, 24, 48, 72, and 168 hours later. (B) Soleus muscle submitted to daily sessions of stretch and evaluated after 24 hours (received 2 stretches), 48 hours (received 3 stretches), and 144 hours (received 7 stretches). Values are mean ± SD. *P≤.005 (ANOVA), as compared with the control group.

Back to Article Outline

Discussion 

The results of this study show that a single session of passive stretch, performed for 30 minutes, induced a 300% increase in myoD mRNA when compared with the control soleus muscle, but did not change the gene expressions of myostatin and atrogin-1. As described in the literature, muscles immobilized in a lengthened position by a plaster cast, present an increase in the myoD gene expression.11, 16, 17, 45 However, in these earlier studies, the muscles were maintained immobilized in a stretched position for long periods, whereas in the present study the stretch was performed for a short period of time (30min).

A notable outcome of the present study is that a single session of stretch performed for 30 minutes was enough to induce an increase in the level of myoD mRNA, taking 24 hours to be detected, whereas in the muscles subjected to daily stretches, the myoD gene expression displayed no difference compared with the control group. These results suggest that the myoD gene expression depends on the time and also on the number of stretch stimuli applied to the muscle. Note that a single stretch increased the myoD mRNA level 24 hours later, but 2 stretches blocked this effect (see figs 1A, B, respectively). Conflicting studies have been reported regarding myoD gene expression. Previous reports using chicken muscles as the model found no increase in the myoD mRNA levels after 3, 6, 14, and 21 days of immobilization in the stretched position.15, 20 To the contrary, Eppley et al46 observed high expression of qmf1, an avian homolog of myoD, after 3 to 16 hours in muscles submitted to a model of stretch-induced injury. Zador et al17 also found an increase in the myoD expression of the rat soleus muscle maintained in an extended position for 3 days. Hill and Goldspink45 also showed an increase in the myoD gene expression in the rat anterior tibialis muscle, after 1 day of immobilization in a lengthened position associated with 1 hour of electric stimulation. Peters et al30 also reported an increase in myoD transcripts in the anterior tibialis muscle of the rat, 3 hours after a single bout of 30 eccentric contractions applied to the muscle maintained in a stretched position.

In view of the aforementioned studies, the discrepancies in myoD gene expression can be attributed to differences in the animal species, muscles, and protocols of stretch application. One possible explanation for the elevation in the myoD mRNA level may be the surge of myoD in proliferating satellite cells early after stretch. Satellite cell proliferation typically begins 24 to 48 hours after regeneration and during the subsequent events, MRFs are still until expressed in these cells.47 Mononuclear cells with myoD peak expression were still described after 24 hours.47 However, a previous study showed that the myoD mRNA level was elevated even in stretched-overloaded muscles irradiated for the elimination of satellite cell proliferation, presenting evidence that myoD activation is not dependent on satellite cell proliferation.16

IGF-1 is a protein growth factor that can induce skeletal muscle hypertrophy by activating the phosphatidylinositol 3-kinase (PI3K)–serine/threonine kinase (Akt) pathway.48 It has been shown that the interaction between Rho, a guanosine triphosphate–binding protein with guanosine triphosphatase activities, and the serum response factor (SRF), a DNA-binding protein, is required for the regulatory pathway that controls the myoD gene expression, and that the Rho/SRF activities are dependent on IGF factors.44, 49, 50 Thus it is tempting to speculate that if IGF is related to hypertrophy and myoD activation depends on Rho/SRF activation, the data found in this work could mean that the increase in myoD mRNA level induced by a single session of passive stretch for 30 minutes was enough to produce a hypertrophic signal. Moreover, it was recently reported that the induction of the IGF-1/PI3K/Akt pathway prevents the induction of requisite atrophy mediators such as atrogin.51 This statement corroborated the present results because myoD and atrogin-1 were never concomitantly upregulated in the stretched soleus muscles.

The present results with myostatin show that its gene expression was not changed either after a single session of passive stretch or when the stretch session was performed daily, which indicates that passive stretches applied for a short period of time did not alter the myostatin gene expression. Recently it was also reported that eccentric exercise induced an upregulation in the myostatin mRNA expression30, 31 whereas concentric training reduced its expression.52 These findings suggest that the level of stress in the muscle fibers could be a determinant factor in the responsiveness of the myostatin gene expression.

The data on the atrogin-1 mRNA levels showed no changes after a single session of stretch but an increase in the atrogin-1 gene expression was found when daily bouts of stretch were performed. To our knowledge, this is the first report on the effect of stretch on the atrogin-1 gene expression. Previous studies have described a decrease in the muscle fiber CSA after stretch in the rat soleus muscle,32, 33 suggesting an involvement of cellular degradation pathways. The results of the present study confirm this hypothesis because the atrogin-1 gene expression was upregulated after daily stretches.

Overall, the present study provides new evidence on the effect of passive stretch for short periods of time in the expression of genes related to skeletal muscle hypertrophy and atrophy. Furthermore, it would be interesting for rehabilitation and sports medicine if similar procedures were also evaluated in human muscles.

Back to Article Outline

Conclusions 

A single session of passive stretch for 30 minutes increased myoD gene expression, suggesting a hypertrophic effect. However, daily sessions of stretch blocked this effect and increased atrogin-1 gene expression, which has been primarily associated with muscle atrophy. Thus, passive stretch alters both hypertrophic and atrophic skeletal muscle mechanisms. Also, the number of stretch sessions was determinant in both atrogin-1 and myoD responsiveness.

Suppliers

Back to Article Outline

Acknowledgment 

We thank Marcia Gislene, BSc, for providing technical assistance.

Back to Article Outline

References 

  1. Williams PE . Effect of intermittent stretch on immobilized muscle . Ann Rheum Dis . 1988;47:1014–1016
  2. Goldspink G . Molecular mechanism involved in the determination of muscle fiber mass and phenotype . Adv Exerc Sports Physiol . 1999;5(2):27–39
  3. Goldspink G , Williams P , Simpson H . Gene expression in response to muscle stretch . Clin Orthop Relat Res . 2002;403(Suppl):S146–S152
  4. Sola OM , Christensen DL , Martín AW . Hypertrophy and hyperplasia of adult chicken anterior latissimus dorsi muscles following stretch with and without denervation . Exp Neurol . 1973;41:76–100
  5. Alway SE , Winchester PK , Davis ME , Gonyea WJ . Regionalized adaptations and muscle fiber proliferation in stretch-induced enlargement . J Appl Physiol . 1989;66:771–781
  6. Goldspink G , Scutt A , Loughna PT , Wells DJ , Jaencke T , Gerlach GF . Gene expression in skeletal muscle in response to stretch and force generation . Am J Physiol . 1992;22:R356–R363
  7. Williams PE . Use of intermittent stretch in the prevention of serial sarcomere loss in immobilised muscle . Ann Rheum Dis . 1990;49:316–317
  8. Coutinho EL , Gomes AR , França CN , Salvini TF . Effect of passive stretching on the immobilized soleus muscle fiber morphology . Braz J Med Biol Res . 2004;37:1853–1861
  9. Yang JC , Cortopassi GA . Induction of the mitochondrial permeability transition causes release of the apoptogenic factor cytochrome C . Free Radic Biol Med . 1998;24:624–631
  10. Mckoy G , Ashley W , Mander J , et al.   Expression of IGF-1 splice variants and structural genes in rabbit skeletal muscle and induced by stretch and stimulation . J Physiol . 1999;516:583–592
  11. Lowe DA , Lund T , Alway SE . Hypertrophy-stimulated myogenic regulatory factor mRNA increases are attenuated in fast muscle of aged quails . Am J Physiol Cell Physiol . 1998;275:C155–C162
  12. Saborin LA , Rudnick MA . The molecular regulation of myogenesis . Clin Genet . 2000;57:16–25
  13. Ludolph DC , Konieczny SF . Transcription factor families (muscling in on the myogenic program) . FASEB J . 1995;9:1595–1604
  14. Jacobs-El J , Zhou M , Russell B . MRF4, Myf-5, and myogenin mRNAs in the adaptive responses of mature rat muscle . Am J Physiol . 1995;268(4 Pt 1):C1045–C1052
  15. Carson JA , Booth FW . Myogenin mRNA is elevated during rapid, slow, and maintenance phases of stretch-induced hypertrophy in chicken slow-tonic muscle . Pflugers Arch . 1998;435:850–858
  16. Lowe DA , Alway SE . Stretch-induced myogenin, MyoD, and MRF4 expression and acute hypertrophy in quail slow-tonic muscle are not dependent upon satellite cell proliferation . Cell Tissue Res . 1999;296:531–539
  17. Zador E , Dux L , Wuytack F . Prolonged passive stretch of rat soleus muscle provokes an increase in the mRNA levels of the muscle regulatory factors distributed along the entire length of the fibers . J Muscle Res Cell Motil . 1999;20:395–402
  18. Owino V , Yang SY , Goldspink G . Age-related loss of skeletal muscle function and the inability to express the autocrine form of insulin-like growth factor-1 (MGF) in response to mechanical overload . FEBS Lett . 2001;505:259–263
  19. Carson JA , Yan Z , Booth FW , Coleman ME , Schwartz RJ , Stump CS . Regulation of skeletal α-actin promoter in young chickens during hypertrophy caused by stretch overload . Am J Physiol . 1995;268:C918–C924
  20. Carson JA , Schwartz RJ , Booth FW . SRF and TEF-1 control of chicken skeletal α-actin gene during slow-muscle hypertrophy . Am J Physiol . 1996;270(4 Pt 1):C1624–C1633
  21. Gregory P , Gagnon J , Essing DA , Reid SK , Prior G , Zak R . Differential regulation of actin and myosin isoenzyme synthesis in functionally overloaded skeletal muscle . Biochem J . 1990;265:525–532
  22. Laurent GJ , Sparrow MP , Millward DJ . Turnover of muscle protein in the fowl (changes in rates of protein synthesis and breakdown during hypertrophy of the anterior and posterior latissimus dorsi muscles) . Biochem J . 1978;176:407–417
  23. Loughna PT , Brownson C . Two myogenic regulatory factor transcripts exhibit muscle-specific responses to disuse and passive stretch in adult rats . FEBS Lett . 1996;390:304–306
  24. McPherron A , Lawer A , Lee S . Regulation of skeletal muscle mass in mice by a new TGF-β superfamily member . Nature . 1997;386:83–90
  25. Carlson C , Booth F , Gordon S . Skeletal muscle myostatin mRNA expression in fiber-type specific and increases during hindlimb unloading . Am J Physiol . 1999;277(2 Pt 2):R601–R606
  26. Willoughby D , Rosene J . Effects of oral creatine and resistance training on myosin heavy chain expression . Med Sci Sports Exerc . 2001;33:1674–1681
  27. Wehling M , Cai B , Tidball JG . Modulation of myostatin expression during modified muscle use . FASEB J . 2000;14:103–110
  28. Bogdanovich S , Krag T , Barton E , et al.   Functional improvement of dystrophic muscle by myostatin blockade . Nature . 2002;420:418–421
  29. Whittemore LA , Song K , Li X , et al.   Inhibition of myostatin in adult mice increases skeletal muscle mass and strength . Biochem Biophys Res Commun . 2002;300:965–971
  30. Peters D , Barash IA , Burdi M , et al.   Asynchronous functional, cellular and transcriptional changes after a bout of eccentric exercise in the rat . J Physiol . 2003;553(Pt 3):947–957
  31. Willoughby DS . Effects of heavy resistance training on myostatin mRNA and protein expression . Med Sci Sports Exerc . 2004;36:574–582
  32. Stauber WT , Miller GR , Grimmett JG , Knack KK . Adaptation of rat soleus muscles to 4 wk of intermittent strain . J Appl Physiol . 1994;77:58–62
  33. Gomes AR , Coutinho EL , França CN , Polonio J , Salvini TF . The effect of one stretch a week applied to the immobilized soleus muscle on rat muscle fiber morphology . Braz J Med Biol Res . 2004;37:1473–1480
  34. Mitch WE , Goldberg AL . Mechanisms of muscle wasting (the role of the ubiquitin-proteasome pathway) . N Engl J Med . 1996;335:1897–1905
  35. Lecker SH , Solomon V , Mitch WE , Goldberg AL . Muscle protein breakdown and the critical role of the ubiquitin-proteasome pathway in normal and disease state . J Nutr . 1999;129(12 Suppl):227S–237S
  36. Gomes MD , Lecker SH , Jagoe RT , Navon A , Goldberg AL . Atrogin-1, a muscle-specific F-box protein highly expressed during muscle atrophy . Proc Natl Acad Sci U S A . 2001;98:14440–14445
  37. Bodine SC , Latres E , Baumhueter S , et al.   Identification of ubiquitin ligases required for skeletal muscle atrophy . Science . 2001;294:1704–1708
  38. Booth FW , Kelso JR . Production of rat muscle atrophy by cast fixation . J Appl Physiol . 1973;34:404–406
  39. Ansved T . Effects of immobilization on the rat soleus muscle in relation to age . Acta Physiol Scand . 1995;154:291–302
  40. Harjola VP , Jankala H , Harkonen M . Myosin heavy chain mRNA and protein distribution in immobilized rat skeletal muscle are not affected by testosterone status . Acta Physiol Scand . 2000;169:277–282
  41. Ikeda S , Yoshida A , Matayoshi S , Tanaka N . Repetitive stretch induces c-fos and myogenin mRNA within several hours in skeletal muscle removed from rats . Arch Phys Med Rehabil . 2003;84:419–423
  42. Ikeda S , Yoshida A , Matayoshi S , Horinouchi K , Tanaka N . Induction of myogenin messenger ribonucleic acid in rat skeletal muscle after 1 hour of passive repetitive stretching . Arch Phys Med Rehabil . 2004;85:166–167
  43. Hughes SM , Taylor JM , Tapscott SJ , Gurley CM , Carter WJ , Peterson CA . Selective accumulation of MyoD and myogenin mRNAs in fast and slow adult skeletal muscle is controlled by innervation and hormones . Development . 1993;118:1137–1147
  44. Carson JA , Booth FW . Effect of serum and mechanical stretch on skeletal α-actin gene regulation in cultured primary muscle cells . Am J Physiol Cell Physiol . 1998;275(6 Pt 1):C1438–C1448
  45. Hill M , Goldspink G . Expression and splicing of the insulin-like growth factor gene in rodent muscle is associated with muscle satellite (stem) cell activation following local tissue damage . J Physiol . 2003;549(Pt 2):409–418
  46. Eppley ZA , Kim J , Russell B . A myogenic regulatory gene, qmf1, is expressed by adult myonuclei after injury . Am J Physiol . 1993;265(2 Pt 1):397–405
  47. Grounds M , Garrett KL , Lai MC , Wright WE , Beilharz MW . Identification of skeletal muscle precursor cells in vivo by use of myoD1 and myogenin probes . Cell Tissue Res . 1992;267:99–104
  48. Glass D . Molecular mechanisms modulating muscle mass . Trends Mol Med . 2003;9:344–350
  49. Hill CS , Wynne J , Treisman R . The Rho family GTPases RhoA, Rac1, and CDC42Hs regulate transcriptional activation by SRF . Cell . 1995;81:1159–1170
  50. Carnac G , Primig M , Kitzmann M , et al.   RhoA GTPase and serum response factor control selectively the expression of MyoD without affecting Myf5 in mouse myoblasts . Mol Biol Cell . 1998;9:1891–1902
  51. Stitt TN , Drujan D , Clarke BA , et al.   The IGF-1/PI3K/Akt pathway prevents short article expression of muscle atrophy-induced ubiquitin ligases by inhibiting FOXO transcription factors . Mol Cell . 2004;14:395–403
  52. Roth S , Martel G , Ferrel R , Metter E , Hurley B , Rogers M . Myostatin gene expression is reduced in humans with heavy-resistance strength training (a brief communication) . Exp Biol Med . 2003;228:706–709
  • a Invitrogen Corp, 1600 Faraday Ave, PO Box 6482, Carlsbad, CA 92008.
  • b Applied Biosystems, 850 Lincoln Centre Dr, Foster City, CA 94404.

 Supported by the Fundação de Amparo à Pesquisa do Estado de São Paulo (grant nos. 01/13523-4, 01/135221-1, 03/10889-3), Coordenção de Aperfeiçoamento de Pessoal de Nivel Superior (grant no. 33001014016P7), and Conselho Nacional de Desenvolvimento Científico e Tecnológico (grant no. 501737/2004-9).No commercial party having a direct financial interest in the results of the research supporting this article has or will confer a benefit upon the authors or upon any organization with which the authors are associated.

PII: S0003-9993(05)01194-9

doi:10.1016/j.apmr.2005.08.126

Archives of Physical Medicine and Rehabilitation
Volume 87, Issue 2 , Pages 241-246, February 2006

Article Tools

* Image Usage & Resolution